prism 4 statistical software 240 package (GraphPad Software Inc)
GraphPad Software Inc is a verified supplier 
90
Structured Review
GraphPad Software Inc
prism 4 statistical software 240 package
Prism 4 Statistical Software 240 Package, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prism+4+statistical+software+240+package/prism+4+statistical+software+240+package/pmc05757828-130-4-10
Average 90 stars, based on 1 article reviews
Prism 4 Statistical Software 240 Package, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prism+4+statistical+software+240+package/prism+4+statistical+software+240+package/pmc05757828-130-4-10
Average 90 stars, based on 1 article reviews
prism 4 statistical software 240 package - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Software:Article Title: Ovarian matrix metalloproteinases are differentially regulated during the estrous cycle but not during short photoperiod induced regression in Siberian hamsters ( Phodopus sungorus ) Article Snippet: .. All data were analyzed using Article Title: Rapid changes in ovarian mRNA induced by brief photostimulation in Siberian hamsters ( Phodopus sungorus ) Article Snippet: .. Data were analyzed using Article Title: Inhibition of matrix metalloproteinases in Siberian hamsters impedes photostimulated recrudescence of ovaries Article Snippet: .. All data presented were analyzed using Article Title: Inhibition of Matrix Metalloproteinases (MMPs) in Siberian Hamsters Impedes Photostimulated Recrudescence of Ovaries Article Snippet: .. All data presented were analyzed using Article Title: Inhibition of Matrix Metalloproteinases (MMPs) in Siberian Hamsters Impedes Photostimulated Recrudescence of Ovaries Article Snippet: .. Statistical Analysis All data presented were analyzed using Article Title: Differential expression of matrix metalloproteinases during stimulated ovarian recrudescence in Siberian hamsters ( Phodopus sungorus ) Article Snippet: .. All data were analyzed using one-way ANOVAs with the other:Article Title: Differential Ovarian Expression of KiSS-1 and GPR-54 During the Estrous Cycle and Photoperiod Induced Recrudescence in Siberian Hamsters ( Phodopus sungorus ) Article Snippet: One-way ANOVAs followed by a Article Title: Differential Ovarian Expression of KiSS-1 and GPR-54 During the Estrous Cycle and Photoperiod Induced Recrudescence in Siberian Hamsters ( Phodopus sungorus ) Article Snippet: Band density was determined by using NIH Image software as directed. table ft1 table-wrap mode="anchored" t5 Sequence PCR conditions KiSS-1 F- TCGTTAATGCCTGGGAAAAG 96° (5m, 1 cycle) R- CGAAGGAGTTCCAGTTGTAG 96° (30s) 55°(1m) 72°(1m), 219 bp 40 cycles, 72° (7m) GPR54 F- GGCTGGTTCCTCTGTTCTTC 95° (5m, 1 cycle) R- TGGCGATGTAGAAGTTGGTC 95° (30s) 54°(1m) 72°(1m), 166 bp 36 cycles, 72° (7m) β-actin F- GAAATCGTGCGTGACATC 94° (1m, 1 |